Islatravir Dimer: Crystal Form Dependence of a Radiation-Induced Degradation Product.

A rare example of crystal form-dependent, gamma radiation-induced degradation is presented. Islatravir is known to exist in several polymorphic forms, but only one of these forms shows the generation of a specific dimer degradation product under gamma irradiation. Extended gamma irradiation studies demonstrated that only one of the known crystalline forms shows an appreciable rate of dimer formation. Additionally, this dimer is not observed to form under other forced stress conditions. We present the structural elucidation of this dimer impurity and rationalize its form-dependent generation based on the analysis of the underlying crystal structure.

Decreased Transition-State Analogue Affinity in Isotopically Heavy MTAN with Increased Catalysis.

5'-Methylthioadenosine/S-adenosylhomocysteine nucleosidase from Helicobacter pylori (HpMTAN) demonstrated faster chemistry when expressed as an isotopically heavy protein, with 2H, 13C, and 15N replacing the bulk of normal isotopes. The inverse heavy enzyme isotope effect has been attributed to improved enzyme-reactant interactions causing more frequent transition-state formation ( Proc. Natl. Acad. Sci. U.S.A. 2021, 118, e2109118118). Transition-state analogues stabilize the transient dynamic geometry of the transition state and inform on transition-state dynamics. Here, a slow-onset, tight-binding transition-state analogue of HpMTAN is characterized with heavy and light enzymes. Dissociation constants for the initial encounter complex (Ki) and for the tightly bound complex after slow-onset inhibition (Ki*) with hexylthio-DADMe-Immucillin-A (HTDIA) gave Ki values for light and heavy HpMTAN = 52 ± 10 and 85 ± 13 pM and Ki* values = 5.9 ± 0.3 and 10.0 ± 1.2 pM, respectively. HTDIA dissociates from heavy HpMTAN at 0.063 ± 0.002 min-1, faster than that from light HpMTAN at 0.032 ± 0.004 min-1. These values are consistent with transition-state formation by an improved catalytic site dynamic search and inconsistent with catalytic efficiency proportional to tight binding of the transition state.

Residence Times for Femtomolar and Picomolar Inhibitors of MTANs.

5'-Methylthioadenosine nucleosidases (MTANs) catalyze the hydrolysis of 5'-substituted adenosines to form adenine and 5-substituted ribose. Escherichia coli MTAN (EcMTAN) and Helicobacter pylori MTAN (HpMTAN) form late and early transition states, respectively. Transition state analogues designed for the late transition state bind with fM to pM affinity to both classes of MTANs. Here, we compare the residence times (off-rates) with the equilibrium dissociation constants for HpMTAN and EcMTAN, using five 5'-substituted DADMe-ImmA transition state analogues. The inhibitors dissociate orders of magnitude slower from EcMTAN than from HpMTAN. For example, the slowest release rate was observed for the EcMTAN-HTDIA complex (t1/2 = 56 h), compared to a release rate of t1/2 = 0.3 h for the same complex with HpMTAN, despite similar structures and catalytic sites for these enzymes. Other inhibitors also reveal disconnects between residence times and equilibrium dissociation constants. Residence time is correlated with pharmacological efficacy; thus, experimental analyses of dissociation rates are useful to guide physiological function of tight-binding inhibitors. Steered molecular dynamics simulations for the dissociation of an inhibitor from both EcMTAN and HpMTAN provide atomic level mechanistic insight for the differences in dissociation kinetics and inhibitor residence times for these enzymes.

Selective Unnatural Base Pairing and Recognition of 2-Hydroxy-2'-deoxyadenosine in DNA Using Pseudo-dC Derivatives.

The formation of unnatural base pairs within duplex DNA would facilitate DNA nanotechnology and biotechnology. Iso-2'-deoxyguanosine (iso-dG) forms base pairs with iso-2'-deoxycytidine, and its use as an unnatural base pair was investigated. Iso-dG is one of the tautomers of 2-hydroxy-2'-deoxyadenosine (2-OH-dA), known as an oxidatively damaged nucleobase, and its selective recognition in DNA plays an important role in the diagnosis and pathogenesis of disease. Therefore, we focused on pseudo-dC (ψdC) as a suitable molecule that recognizes 2-OH-dA in DNA. Since 2-OH-dA shows tautomeric structures in DNA, we designed and used ψdC, which also has a tautomeric structure. We successfully synthesized a ψdC phosphoramidite compound for the synthesis of oligonucleotides (ODNs) as well as its triphosphate derivative (ψdCTP). Tm measurements revealed that ODNs including ψdC showed stable base pair formation with ODNs having 2-OH-dA. In contrast, low Tm values were observed for other bases (dG, dA, dC, and T). The results obtained for the single-nucleotide primer extension reaction revealed that ψdCTP was incorporated into the complementary position of 2-OH-dA in template DNA with high selectivity. In addition, the primer elongation reaction was confirmed to proceed in the presence of dNTPs. The present study reports an artificial nucleic acid that selectively and stably forms unnatural base pairs with 2-OH-dA in DNA.

The molecular recognition of cordycepin arabinoside and analysis of changes on cordycepin and its arabinoside in fruiting body and pupa of Cordyceps militaris.

Cordyceps militaris is an edible fungus that is widely used as a functional food in many countries. In order to objectively evaluate its nutritional value, free and glycosidic cordycepins need to be analyzed. The cordycepin arabinoside molecule was recognized by the MS2 fragmentation rule, and both cordycepin and its arabinoside were quantitatively analyzed in the fruiting body and pupa of Cordyceps militaris by high-performance liquid chromatography with tandem mass spectrometric (HPLC-MS/MS). The method had good linear regression (R2 = 0.9999), with a detection limit of 0.021 ng/mL. The recovery range was 94.32-103.09% in the fruiting body and pupa. The content of cordycepin and its arabinoside showed an upward trend with growth, and the total contents reached the highest level at the mature stage (60-70th day) without mildew. This study provides a useful reference for the evaluation and application of Cordyceps militaris as a functional food resource.

Mechanistic investigation of B12-independent glycerol dehydratase and its activating enzyme GD-AE.

B12-Independent glycerol dehydratase (GD) is a glycyl radical enzyme in the biotransformation of glycerol to 1,3-propanediol. GD requires the activating enzyme GD-AE to initiate the radical reaction. GD-AE belongs to the radical S-adenosyl-L-methionine (SAM) enzyme superfamily. However, a previous study showed that GD-AE cleaves SAM unconventionally to generate 5'-deoxy-5'-methylthioadenosine. Herein, we show that GD-AE actually cleaves SAM to form 5'-deoxyadenosine, similar to other radical SAM enzymes. Furthermore, with the synthesized glycerol analogue 2-deoxy-2-fluoroglycerol, we demonstrate that B12-independent GD catalyzes the glycerol dehydration reaction by direct elimination of the C-2 hydroxyl group of a ketyl radical rather than 1,2-OH migration.

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or ß-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.

The B12-independent glycerol dehydratase activating enzyme from Clostridium butyricum cleaves SAM to produce 5'-deoxyadenosine and not 5'-deoxy-5'-(methylthio)adenosine.

Glycerol dehydratase activating enzyme (GD-AE) is a radical S-adenosyl-l-methionine (SAM) enzyme that installs a catalytically essential amino acid backbone radical onto glycerol dehydratase in bacteria under anaerobic conditions. Although GD-AE is closely homologous to other radical SAM activases that have been shown to cleave the S-C(5') bond of SAM to produce 5'-deoxyadenosine (5'-dAdoH) and methionine, GD-AE from Clostridium butyricum has been reported to instead cleave the S-C(γ) bond of SAM to yield 5'-deoxy-5'-(methylthio)adenosine (MTA). Here we re-investigate the SAM cleavage reaction catalyzed by GD-AE and show that it produces the widely observed 5'-dAdoH, and not the less conventional product MTA.

Genotoxic C8-Arylamino-2'-deoxyadenosines Act as Latent Alkylating Agents to Induce DNA Interstrand Cross-Links.

DNA interstrand cross-links (ICLs) are extremely deleterious and structurally diverse, driving the evolution of ICL repair pathways. Discovering ICL-inducing agents is, thus, crucial for the characterization of ICL repair pathways and Fanconi anemia, a genetic disease caused by mutations in ICL repair genes. Although several studies point to oxidative stress as a cause of ICLs, oxidative stress-induced cross-linking events remain poorly characterized. Also, polycyclic aromatic amines, potent environmental carcinogens, have been implicated in producing ICLs, but their identities and sequences are unknown. To close this knowledge gap, we tested whether ICLs arise by the oxidation of 8-arylamino-2'-deoxyadenosine (ArNHdA) lesions, adducts produced by arylamino carcinogens. Herein, we report that ArNHdA acts as a latent cross-linking agent to generate ICLs under oxidative conditions. The formation of an ICL from 8-aminoadenine, but not from 8-aminoguanine, highlights the specificity of 8-aminopurine-mediated ICL production. Under the influence of the reactive oxygen species (ROS) nitrosoperoxycarbonate, ArNHdA (Ar = biphenyl, fluorenyl) lesions were selectively oxidized to generate ICLs. The cross-linking reaction may occur between the C2-ArNHdA and N2-dG, presumably via oxidation of ArNHdA into a reactive diiminoadenine intermediate followed by the nucleophilic attack of the N2-dG on the diiminoadenine. Overall, ArNHdA-mediated ICLs represent rare examples of ROS-induced ICLs and polycyclic aromatic amine-mediated ICLs. These results reveal novel cross-linking chemistry and the genotoxic effects of arylamino carcinogens and support the hypothesis that C8-modified adenines with low redox potential can cause ICLs in oxidative stress.

Uric Acid as a Photosensitizer in the Reaction of Deoxyribonucleosides with UV Light of Wavelength Longer than 300 nm: Identification of Products from 2'-Deoxycytidine.

DNA reacts directly with UV light with a wavelength shorter than 300 nm. Although ground surface sunlight includes little of this short-wavelength UV light due to its almost complete absorption by the atmosphere, sunlight is the primary cause of skin cancer. Photosensitization by endogenous substances must therefore be involved in skin cancer development mechanisms. Uric acid is the final metabolic product of purines in humans, and is present at relatively high concentrations in cells and fluids. When a neutral mixed solution of 2'-deoxycytidine, 2'-deoxyguanosine, thymidine, and 2'-deoxyadenosine was irradiated with UV light with a wavelength longer than 300 nm in the presence of uric acid, all the nucleosides were consumed in a uric acid dose-dependent manner. These reactions were inhibited by the addition of radical scavengers, ethanol and sodium azide. Two products from 2'-deoxycytidine were isolated and identified as N4-hydroxy-2'-deoxycytidine and N4,5-cyclic amide-2'-deoxycytidine, formed by cycloaddition of an amide group from uric acid. A 15N-labeled uric acid, uric acid-1,3-15N2, having two 14N and two 15N atoms per molecule, produced N4,5-cyclic amide-2'-deoxycytidine containing both 14N and 15N atoms from uric acid-1,3-15N2. Singlet oxygen, hydroxyl radical, peroxynitrous acid, hypochlorous acid, and hypobromous acid generated neither N4-hydroxy-2'-deoxycytidine nor N4,5-cyclic amide-2'-deoxycytidine in the presence of uric acid. These results indicate that uric acid is a photosensitizer for the reaction of nucleosides by UV light with a wavelength longer than 300 nm, and that an unidentified radical derived from uric acid with a delocalized unpaired electron may be generated.

Cordycepin Attenuates Palmitic Acid-Induced Inflammation and Apoptosis of Vascular Endothelial Cells through Mediating PI3K/Akt/eNOS Signaling Pathway.

A well-known medicinal mushroom in the field of traditional Chinese medicine, Cordyceps sinensis, is a rare natural-occurring entomopathogenic fungus, and it typically grows at high altitudes on the plateau of the Himalayan. Previous studies indicated that cordycepin, the main bioactive chemical of Cordyceps sinensis, has very potent anticancer, anti-oxidant and anti-inflammatory activities. However, its protective effects against atherosclerotic changes in vascular endothelial cells have not been fully elucidated. In this study, we showed that pretreatment with cordycepin significantly attenuated palmitic acid (PA)-induced cytotoxicity, reactive oxygen species (ROS) generation, and inflammatory responses. We found that PA decreased phosphorylation of Akt, eNOS, and bioavailability of nitric oxide (NO), which in turn activated NF-[Formula: see text]B and the downstream inflammatory responses. All these detrimental events were markedly blocked by pretreatment with cordycepin. Moreover, cordycepin ameliorated destabilization of mitochondrial permeability, cytosolic calcium rises, and apoptotic features caused by PA. In addition, all these anti-inflammatory and anti-apoptosis effects of cordycepin were found to be inhibited by the PI3K and eNOS inhibitor, suggesting that its anti-atherosclerotic effects may partially be mediated by the PI3K/Akt/eNOS signaling pathway.

Radical Dehalogenation and Purine Nucleoside Phosphorylase E. coli: How Does an Admixture of 2',3'-Anhydroinosine Hinder 2-fluoro-cordycepin Synthesis.

During the preparative synthesis of 2-fluorocordycepin from 2-fluoroadenosine and 3'-deoxyinosine catalyzed by E. coli purine nucleoside phosphorylase, a slowdown of the reaction and decrease of yield down to 5% were encountered. An unknown nucleoside was found in the reaction mixture and its structure was established. This nucleoside is formed from the admixture of 2',3'-anhydroinosine, a byproduct in the preparation of 3-'deoxyinosine. Moreover, 2',3'-anhydroinosine forms during radical dehalogenation of 9-(2',5'-di-O-acetyl-3'-bromo- -3'-deoxyxylofuranosyl)hypoxanthine, a precursor of 3'-deoxyinosine in chemical synthesis. The products of 2',3'-anhydroinosine hydrolysis inhibit the formation of 1-phospho-3-deoxyribose during the synthesis of 2-fluorocordycepin. The progress of 2',3'-anhydroinosine hydrolysis was investigated. The reactions were performed in D2O instead of H2O; this allowed accumulating intermediate substances in sufficient quantities. Two intermediates were isolated and their structures were confirmed by mass and NMR spectroscopy. A mechanism of 2',3'-anhydroinosine hydrolysis in D2O is fully determined for the first time.

Dynamic content changes of cordycepin and adenosine and transcriptome in Cordyceps kyushuensis Kob at different fermentation stages.

20% (w/w) Astragali radix was added to the rice medium to cultivate C. kyushuensis Kob. The fermentation product was collected at mycelium stage, coloring stage, stromata-forming initial stage and fruiting body stage of C. kyushuensis Kob. The dynamic content changes of cordycepin and adenosine were detected at different fermentation stages. In the rice medium with Astragalus radix, both cordycepin and adenosine reached the highest content value on the 30th day of fermentation, 17.31 mg/g and 0.94 mg/g, respectively, which were 8.6 times and 2.0 times of that in rice medium at the same stage. At the same time, transcriptomics technology was used to analyze C. kyushuensis Kob during these four periods.

Investigation of 2'-Deoxyadenosine-Derived Adducts Specifically Formed in Rat Liver and Lung DNA by N'-Nitrosonornicotine Metabolism.

The International Agency for Research on Cancer has classified the tobacco-specific nitrosamines N'-nitrosonornicotine (NNN) and 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) as "carcinogenic to humans" (Group 1). To exert its carcinogenicity, NNN requires metabolic activation to form reactive intermediates which alkylate DNA. Previous studies have identified cytochrome P450-catalyzed 2'-hydroxylation and 5'-hydroxylation of NNN as major metabolic pathways, with preferential activation through the 5'-hydroxylation pathway in some cultured human tissues and patas monkeys. So far, the only DNA adducts identified from NNN 5'-hydroxylation in rat tissues are 2-[2-(3-pyridyl)-N-pyrrolidinyl]-2'-deoxyinosine (Py-Py-dI), 6-[2-(3-pyridyl)-N-pyrrolidinyl]-2'-deoxynebularine (Py-Py-dN), and N6-[4-hydroxy-1-(pyridine-3-yl)butyl]-2'-deoxyadenosine (N6-HPB-dAdo) after reduction. To expand the DNA adduct panel formed by NNN 5'-hydroxylation and identify possible activation biomarkers of NNN metabolism, we investigated the formation of dAdo-derived adducts using a new highly sensitive and specific liquid chromatography-nanoelectrospray ionization-high-resolution tandem mass spectrometry method. Two types of NNN-specific dAdo-derived adducts, N6-[5-(3-pyridyl)tetrahydrofuran-2-yl]-2'-deoxyadenosine (N6-Py-THF-dAdo) and 6-[2-(3-pyridyl)-N-pyrrolidinyl-5-hydroxy]-2'-deoxynebularine (Py-Py(OH)-dN), were observed for the first time in calf thymus DNA incubated with 5'-acetoxyNNN. More importantly, Py-Py(OH)-dN was also observed in relatively high abundance in the liver and lung DNA of rats treated with racemic NNN in the drinking water for 3 weeks. These new adducts were characterized using authentic synthesized standards. Both NMR and MS data agreed well with the proposed structures of N6-Py-THF-dAdo and Py-Py(OH)-dN. Reduction of Py-Py(OH)-dN by NaBH3CN led to the formation of Py-Py-dN both in vitro and in vivo, which was confirmed by its isotopically labeled internal standard [pyridine-d4]Py-Py-dN. The NNN-specific dAdo adducts Py-THF-dAdo and Py-Py(OH)-dN formed by NNN 5'-hydroxylation provide a more comprehensive understanding of the mechanism of DNA adduct formation by NNN.

Enzymatic bypass of an N6-deoxyadenosine DNA-ethylene dibromide-peptide cross-link by translesion DNA polymerases.

Unrepaired DNA-protein cross-links, due to their bulky nature, can stall replication forks and result in genome instability. Large DNA-protein cross-links can be cleaved into DNA-peptide cross-links, but the extent to which these smaller fragments disrupt normal replication is not clear. Ethylene dibromide (1,2-dibromoethane) is a known carcinogen that can cross-link the repair protein O6-alkylguanine-DNA alkyltransferase (AGT) to the N6 position of deoxyadenosine (dA) in DNA, as well as four other positions in DNA. We investigated the effect of a 15-mer peptide from the active site of AGT, cross-linked to the N6 position of dA, on DNA replication by human translesion synthesis DNA polymerases (Pols) η, ⍳, and κ. The peptide-DNA cross-link was bypassed by the three polymerases at different rates. In steady-state kinetics, the specificity constant (kcat/Km) for incorporation of the correct nucleotide opposite to the adduct decreased by 220-fold with Pol κ, tenfold with pol η, and not at all with Pol ⍳. Pol η incorporated all four nucleotides across from the lesion, with the preference dT > dC > dA > dG, while Pol ⍳ and κ only incorporated the correct nucleotide. However, LC-MS/MS analysis of the primer-template extension product revealed error-free bypass of the cross-linked 15-mer peptide by Pol η. We conclude that a bulky 15-mer peptide cross-linked to the N6 position of dA can retard polymerization and cause miscoding but that overall fidelity is not compromised because only correct pairs are extended.

The conversion of L-lysine into L-ß-lysine: the role of 5'-deoxyadenosyl radical and water-a DFT study.

In the current study, we deal with the crucial role of 5'-deoxyadenosyl radical and water in the mechanism of the conversion of L-lysine into L-ß-lysine. The DFT (density functional theory)-B3LYP method coupled with 6-31G(d) basis set has been performed to investigate the optimized structures of transition states (TSs) and intermediates (IMs) of two processes in water: (i) the attack of 5'-deoxyadenosyl radical to complex PLP-L-lysine and (ii) hydrolysis to liberate L-ß-lysine. Meanwhile, M062X/6-311++g(3df,2p) level of theory is applied to compute the relative Gibbs energy ΔG. Procedure (i) has undergone various steps but includes two main structural aziridinyl rings TS2 (ΔG = 4.1 kcal/mol) and TS3 (ΔG = 2.3 kcal/mol). In stage (ii), hydroxy group of water would help to break the bond between ß-NH2 group of L-lysine and PLP better than that of Tyr389.

Repurposing potential of FDA-approved and investigational drugs for COVID-19 targeting SARS-CoV-2 spike and main protease and validation by machine learning algorithm.

The present study aimed to assess the repurposing potential of existing antiviral drug candidates (FDA-approved and investigational) against SARS-CoV-2 target proteins that facilitates viral entry and replication into the host body. To evaluate molecular affinities between antiviral drug candidates and SARS-CoV-2 associated target proteins such as spike protein (S) and main protease (Mpro ), a molecular interaction simulation was performed by docking software (MVD) and subsequently the applicability score was calculated by machine learning algorithm. Furthermore, the STITCH algorithm was used to predict the pharmacology network involving multiple pathways of active drug candidate(s). Pharmacophore features of active drug(s) molecule was also determined to predict structure-activity relationship (SAR). The molecular interaction analysis showed that cordycepin has strong binding affinities with S protein (-180) and Mpro proteins (-205) which were relatively highest among other drug candidates used. Interestingly, compounds with low IC50 showed high binding energy. Furthermore, machine learning algorithm also revealed high applicability scores (0.42-0.47) of cordycepin. It is worth mentioning that the pharmacology network depicted the involvement of cordycepin in different pathways associated with bacterial and viral diseases including tuberculosis, hepatitis B, influenza A, viral myocarditis, and herpes simplex infection. The embedded pharmacophore features with cordycepin also suggested strong SAR. Cordycepin's anti-SARS-CoV-2 activity indicated 65% (E-gene) and 42% (N-gene) viral replication inhibition after 48h of treatment. Since, cordycepin has both preclinical and clinical evidences on antiviral activity, in addition the present findings further validate and suggest repurposing potential of cordycepin against COVID-19.

Radical SAM Enzyme Spore Photoproduct Lyase: Properties of the Ω Organometallic Intermediate and Identification of Stable Protein Radicals Formed during Substrate-Free Turnover.

Spore photoproduct lyase is a radical S-adenosyl-l-methionine (SAM) enzyme with the unusual property that addition of SAM to the [4Fe-4S]1+ enzyme absent substrate results in rapid electron transfer to SAM with accompanying homolytic S-C5' bond cleavage. Herein, we demonstrate that this unusual reaction forms the organometallic intermediate Ω in which the unique Fe atom of the [4Fe-4S] cluster is bound to C5' of the 5'-deoxyadenosyl radical (5'-dAdo•). During catalysis, homolytic cleavage of the Fe-C5' bond liberates 5'-dAdo• for reaction with substrate, but here, we use Ω formation without substrate to determine the thermal stability of Ω. The reaction of Geobacillus thermodenitrificans SPL (GtSPL) with SAM forms Ω within ∼15 ms after mixing. By monitoring the decay of Ω through rapid freeze-quench trapping at progressively longer times we find an ambient temperature decay time of the Ω Fe-C5' bond of τ ≈ 5-6 s, likely shortened by enzymatic activation as is the case with the Co-C5' bond of B12. We have further used hand quenching at times up to 10 min, and thus with multiple SAM turnovers, to probe the fate of the 5'-dAdo• radical liberated by Ω. In the absence of substrate, Ω undergoes low-probability conversion to a stable protein radical. The WT enzyme with valine at residue 172 accumulates a Val•; mutation of Val172 to isoleucine or cysteine results in accumulation of an Ile• or Cys• radical, respectively. The structures of the radical in WT, V172I, and V172C variants have been established by detailed EPR/DFT analyses.

Iron Fenton oxidation of 2'-deoxyguanosine in physiological bicarbonate buffer yields products consistent with the reactive oxygen species carbonate radical anion not the hydroxyl radical.

Product analysis from the iron Fenton oxidation of 2'-deoxyguanosine found reactions in bicarbonate buffer yield 8-oxo-2'-deoxyguanosine and spiroiminodihyantoin consistent with CO3˙-. Reactions in phosphate buffer furnished high yields of sugar oxidation products consistent with HO˙. These observations change the view of DNA oxidation products from the iron-Fenton reaction.